Review



m mulv reverse transcriptase enzyme  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs m mulv reverse transcriptase enzyme
    M Mulv Reverse Transcriptase Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4582 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m+mulv+reverse+transcriptase+enzyme/M-MuLV+Reverse+Transcriptase/pmc12704209-115-14-20
    Average 99 stars, based on 4582 article reviews
    m mulv reverse transcriptase enzyme - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: A pathogenic variant of AMOT leads to isolated X-linked congenital hydrocephalus due to N-terminal truncation
    Article Snippet: RNA was isolated with the NucleoSpin RNA XS isolation kit (Macherey-Nagel), following manufacturer’s instructions. .. Total RNA (0.5–1 μg) was subjected to reverse transcription by using random primers (100 pmol/μL; Invitrogen) and M-MuLV reverse transcriptase enzyme (200,000 U/μL; New England Biolabs). .. Real-time PCR was performed using the StepOne Plus Real-Time PCR System (Thermo Fisher Scientific) with specific primers as follows: forward AMOT130 primer 5′ TGAAGAAGCCAAGGTCCAGT 3′, reverse AMOT130 primer 5′ CCCTCATCTTGGTGCATCTT 3′; and forward RSP9 primer 5′ CTGCTGACGCTTGATGAGAA 3′, reverse RSP9 primer 5′ CAGCTTCATCTTGCCCTCAT 3′.

    Article Title: A pathogenic variant of AMOT leads to isolated X-linked congenital hydrocephalus due to N-terminal truncation
    Article Snippet: RNA was isolated with the NucleoSpin RNA XS isolation kit (Macherey-Nagel), following manufacturer’s instructions. .. Total RNA (0.5–1 μg) was subjected to reverse transcription by using random primers (100 pmol/μL; Invitrogen) and M-MuLV reverse transcriptase enzyme (200,000 U/μL; New England Biolabs). .. Real-time PCR was performed using the StepOne Plus Real-Time PCR System (Thermo Fisher Scientific) with specific primers as follows: forward AMOT130 primer 5′ TGAAGAAGCCAAGGTCCAGT 3′, reverse AMOT130 primer 5′ CCCTCATCTTGGTGCATCTT 3′; and forward RSP9 primer 5′ CTGCTGACGCTTGATGAGAA 3′, reverse RSP9 primer 5′ CAGCTTCATCTTGCCCTCAT 3′.

    Article Title: Notch and LIM-homeodomain protein Arrowhead regulate each other in a feedback mechanism to play a role in wing and neuronal development in Drosophila
    Article Snippet: RNA (2 μg) was treated with DNAse using 1.0 μl 10X reaction buffer, 0.5 μl DNAse (New England Biolabs) and 0.5 μl RNAse inhibitor (1,000 U/ml),and volume was adjusted to 10 μl using DEPC MilliQ water. .. The reaction mixture was incubated at 37°C for 1 h. For single-stranded cDNA preparation, 10 μl of DNAse-treated RNAwas mixed with 1 μl M-MuLV reverse transcriptase enzyme (New England Biolabs), 2 μl of 60 μM random primers, 2 μl of 10× M-MuLV buffer, 1 μl of 10mM dNTP and 1 μl of RNase inhibitor, and nuclease-free water was used to make the total volume to 20 μl. ..

    Article Title: Notch and LIM-homeodomain protein Arrowhead regulate each other in a feedback mechanism to play a role in wing and neuronal development in Drosophila
    Article Snippet: RNA (2 μg) was treated with DNAse using 1.0 μl 10× reaction buffer, 0.5 μl DNAse (New England Biolabs) and 0.5 μl RNAse inhibitor (1000 U ml −1 ), and volume was adjusted to 10 μl using DEPC MilliQ water. .. The reaction mixture was incubated at 37°C for 1 h. For single-stranded cDNA preparation, 10 μl of DNAse-treated RNA was mixed with 1 μl M-MuLV reverse transcriptase enzyme (New England Biolabs), 2 μl of 60 μM random primers, 2 μl of 10× M-MuLV buffer, 1 μl of 10 mM dNTP and 1 μl of RNase inhibitor, and nuclease-free water was used to make the total volume to 20 μl. ..

    Article Title: The Bloom Syndrome and Retinoblastoma patient exhibits two RB1 gene mutations in the germline
    Article Snippet: .. Next, 2 μl of 10-x M-MuLV Reverse Transcriptase buffer (NEB-B0253S), 1 μl RNAseOUT (Invitrogen-100000840); 1 μl M-MuLV Reverse Transcriptase enzyme- (New England Biolabs-M0253S) and 2 μl dNTP ́s [10mM] (Invitrogen-10297-018) were added. ..

    Article Title: Atheroprone Flow Activates SMAD-FOXO1 to drive Endothelial-to-Mesenchymal Transition and Atherosclerosis
    Article Snippet: Cellular RNA was isolated using the NucleoSpin RNA XS isolation kit (Macherey-Nagel) according to the manufacturer’s instructions. .. Total RNA was reversely transcribed by incubating it with random primers (100 pmol μL -1 , Invitrogen) and M-MuLV reverse transcriptase enzyme (200,000 U mL -1 , New England Biolabs) was added per sample. .. RT-qPCR was performed using a StepOnePlus Real-Time PCR System (ThermoFisher Scientific) with specific primers listed below.

    Article Title: Notch and LIM-homeodomain protein Arrowhead regulate each other in a feedback mechanism to play a role in wing and neuronal development in Drosophila .
    Article Snippet: .. The reaction mixture was incubated at 37°C for 1 h. For single-stranded cDNA preparation, 10 μl of DNAse-treated RNA was mixed with 1 μl M-MuLV reverse transcriptase enzyme (New England Biolabs), 2 μl of 60 μM random primers, 2 μl of 10× M-MuLV buffer, 1 μl of 10 mM dNTP and 1 μl of RNase inhibitor, and nuclease-free water was used to make the total volume to 20 μl. ..

    Incubation:

    Article Title: Notch and LIM-homeodomain protein Arrowhead regulate each other in a feedback mechanism to play a role in wing and neuronal development in Drosophila
    Article Snippet: RNA (2 μg) was treated with DNAse using 1.0 μl 10X reaction buffer, 0.5 μl DNAse (New England Biolabs) and 0.5 μl RNAse inhibitor (1,000 U/ml),and volume was adjusted to 10 μl using DEPC MilliQ water. .. The reaction mixture was incubated at 37°C for 1 h. For single-stranded cDNA preparation, 10 μl of DNAse-treated RNAwas mixed with 1 μl M-MuLV reverse transcriptase enzyme (New England Biolabs), 2 μl of 60 μM random primers, 2 μl of 10× M-MuLV buffer, 1 μl of 10mM dNTP and 1 μl of RNase inhibitor, and nuclease-free water was used to make the total volume to 20 μl. ..

    Article Title: Notch and LIM-homeodomain protein Arrowhead regulate each other in a feedback mechanism to play a role in wing and neuronal development in Drosophila
    Article Snippet: RNA (2 μg) was treated with DNAse using 1.0 μl 10× reaction buffer, 0.5 μl DNAse (New England Biolabs) and 0.5 μl RNAse inhibitor (1000 U ml −1 ), and volume was adjusted to 10 μl using DEPC MilliQ water. .. The reaction mixture was incubated at 37°C for 1 h. For single-stranded cDNA preparation, 10 μl of DNAse-treated RNA was mixed with 1 μl M-MuLV reverse transcriptase enzyme (New England Biolabs), 2 μl of 60 μM random primers, 2 μl of 10× M-MuLV buffer, 1 μl of 10 mM dNTP and 1 μl of RNase inhibitor, and nuclease-free water was used to make the total volume to 20 μl. ..

    Article Title: Notch and LIM-homeodomain protein Arrowhead regulate each other in a feedback mechanism to play a role in wing and neuronal development in Drosophila .
    Article Snippet: .. The reaction mixture was incubated at 37°C for 1 h. For single-stranded cDNA preparation, 10 μl of DNAse-treated RNA was mixed with 1 μl M-MuLV reverse transcriptase enzyme (New England Biolabs), 2 μl of 60 μM random primers, 2 μl of 10× M-MuLV buffer, 1 μl of 10 mM dNTP and 1 μl of RNase inhibitor, and nuclease-free water was used to make the total volume to 20 μl. ..

    other:

    Article Title: New insight into role of mast cells in erythrocyte homeostasis and clearance under oxidative stress conditions in vivo
    Article Snippet: Concentration and purity of RNA was estimated by studying absorbance at 260/280 nm and 260/230 nm wavelength with Nanodrop (ND2000, Thermo Scientific) spectrophotometer.



    Similar Products

    90
    Thermo Fisher revertaidtm m-mulv reverse transcriptase enzyme
    Revertaidtm M Mulv Reverse Transcriptase Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m+mulv+reverse+transcriptase+enzyme/revertaidtm+m+mulv+reverse+transcriptase+enzyme/pm40555893-90-9-36
    Average 90 stars, based on 1 article reviews
    revertaidtm m-mulv reverse transcriptase enzyme - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    99
    New England Biolabs m mulv reverse transcriptase enzyme
    M Mulv Reverse Transcriptase Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m+mulv+reverse+transcriptase+enzyme/M-MuLV+Reverse+Transcriptase/pmc12704209-115-14-20
    Average 99 stars, based on 1 article reviews
    m mulv reverse transcriptase enzyme - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs m mulv reverse transcriptase rt enzyme
    M Mulv Reverse Transcriptase Rt Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m+mulv+reverse+transcriptase+enzyme/M-MuLV+Reverse+Transcriptase/pm41630844-123-26-34
    Average 99 stars, based on 1 article reviews
    m mulv reverse transcriptase rt enzyme - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs m mlv reverse transcriptase enzyme
    M Mlv Reverse Transcriptase Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m+mulv+reverse+transcriptase+enzyme/M-MuLV+Reverse+Transcriptase/pmc12594847-470-21-25
    Average 99 stars, based on 1 article reviews
    m mlv reverse transcriptase enzyme - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results